markjiron9718 markjiron9718

29-10-2019
Business

contestada

A Chinese restaurant finds that when it prices the dinner buffet at $10, the restaurant sells 150 per day. When the price is reduced to $9, the restaurant sells 200 per day. Based on this information, use the average-values formula to find the price elasticity of demand for the dinner buffet. Provide the absolute value of the price elasticity of demand.A. 2.71B. 3.33C. 0.37D. 0.30

Respuesta :

shahzaibnaeem37 shahzaibnaeem37

31-10-2019

Answer:

B. 3.33

Price Elasticity= %change in Qty/%change in price

%change in quantity= 50/150= 33%

%change in price =1/10= 10%

Price elasticity = 33/10=3.33

Explanation:

Answer Link

Otras preguntas

ANSWER ASAP Read the scientific question below. "Does sunlight make plants live?" What is a likely hypothesis for the question? Yes, sunlight makes plants

the endpoints of the side of rectangle ABCD in the coordinate plane are A (3,7)and B(4,1).Find the equation of the line that contains the given segment.the line

5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand.

How were the Ottoman Turks different from other rulers in the Middle East? A. They expelled all Jewish people. B. They were tolerant of other religions. C. They

Which equation is true? 9x2 – 25 = (3x – 5)(3x – 5) 9x2 – 25 = (3x – 5)(3x + 5) 9x2 – 25 = –(3x + 5)(3x + 5) 9x2 – 25 = –(3x + 5)(3x – 5)

Which statement describes a result of the Pequot War and King Philip's War? Most white settlers were forced to move farther west. Colonists and India

When using the Project Approach Curriculum, who decides on the topic or theme for a project? the teachers the director of the school/center the curriculum th

(50 Points Brainliest) The stability of atomic nuclei seems to be related to the ratio of _____. protons to electrons neutrons to protons isotopes to neutrons n

What words are missing from the diagram 1.A,chlorophyll; B, water 2.A,NADPH; B, sunlight 3. A, chlorophyll; B, ATP 4. A, oxygen; B, ATP

Write the equation and solve the problem. The length of a rectangle is four less than twice the width. If the perimeter is 34, find the length and the width.