MissSarah MissSarah

31-01-2015
Mathematics

contestada

a shoe box is 6 inches wide, 11 inches long, and 5 inches high. what is the volume of the box

Respuesta :

jennasprouse jennasprouse

31-01-2015

Volume= length* width* height
V=11*6*5
V=330 inches

Answer Link

kunfgupanda698 kunfgupanda698

31-01-2015

V= L*W*H
6*11 is 66
66*5 is 330
Make sure your answer is to the third power.

Answer Link

Otras preguntas

Many production employees began to talk among themselves about whether they wanted to transfer to a new production facility in a neighboring town. What type of

help please.. Select the correct image. Given triangle A in the coordinate plane, which image shows a dilation of triangle A by a factor of 2 centered at the or

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Shaquil receives total employee benefits that are 13. 5% of his gross annual pay. If Shaquil has a gross annual pay of $40,000, how much in total employee benef

How do you write 1.75 trillion, 1.75 quadrillion

The following is a necessary tool when working on a computer:.

find the value of x²+y² if x+y=9 xy=14

Explain four reasons of preserving farm produce

In choosing a topic for a speech, you should always consider whether it is _____________ and _____________ . a. appropriate; interesting b. narrow; interesting

When driving in heavy rain or on a flooded road your tires.